Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
circFNDC3B | |||
Gene | FNDC3B | Organism | Human |
Genome Locus | Build | hg19 | |
Disease | Bladder Cancer | ICD-10 | Malignant neoplasm of Bladder, unspecified (C67.9) |
DBLink | PMID | 30458784 | |
Experimental Method | |||
Sample Type | Tissue and cell lines | Comparison | Eighty-two cases of fresh BC tissues and fifty-six paired adjacent noncancerous tissues (≥3 cm away |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward CAAGAAGCAGCCCAAAGTCG ReverseCATGGCTGAGGGGTAGCTTG | Statistics | Fold Change : Downregulated pvalue : <0.05 |
Citation | |||
Liu, H, Bi, J, Dong, W, Yang, M, Shi, J, Jiang, N, Lin, T, Huang, J (2018). Invasion-related circular RNA circFNDC3B inhibits bladder cancer progression through the miR-1178-3p/G3BP2/SRC/FAK axis. Mol. Cancer, 17, 1:161. |